Ezakiella coagulans

On-target is the proportion of detected RI reference genomes assigned to the target; RI genome sensitivity is the proportion of target RI reference genomes detected.

Primer	Species	LP	RP	Tml	Tmr	Length	Score ⇅	On-target ⇅	RI genome sensitivity ⇅
Primer 1001	Ezakiella coagulans	AGTGGCGAATCCTCATCTCA	AGATGTGCTTTCGGTCCGA	58.51	59.03	197	9	100.00% Complete 100.00%	100.00% Complete 100.00%
Primer 1002	Ezakiella coagulans	AAGGGCACTTGCGGTTGA	GCTCGCCTGTCCGATGTTA	59.81	59.86	154	0	100.00% Complete 100.00%	100.00% Complete 100.00%

Showing 1001 to 1002 (all 101 pages)